• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for Necora puber

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: FDA305A
Common Name: Velvet Crab
FDA Market Name: n/a
Voucher Location*: NMNH
Voucher Number: ULLZ17805
Metadata: Seafood Expo North America, FDA, collected 2016
Barcode: 5' barcode (~655 bp):
>ULLZ17805_FDA305A_Necora_puber TACATTATATTTTATCTTTGGAGCTTGAGCAGGAATAGTAGGTACTTCCCTAAGTTTAATTATTCGTGCTGAATTAGGCCAACCAGGAACATTGATTGGAAATGATCAAATTTATAACGTAGTTGTTACCGCCCATGCTTTTGTAATAATCTTCTTCATGGTTATACCAATTATAATTGGTGGATTTGGTAATTGACTAGTACCCTTGATACTAGGTGCTCCAGATATGGCTTTTCCCCGTATAAATAATATAAGATTTTGACTTCTTCCTCCCTCGCTCACTCTATTACTAATAAGTGGGTTAGTTGAAAGAGGTGTTGGTACTGGTTGAACTGTTTACCCTCCCTTATCTGCAGCTATTGCCCACGCGGGTGCTTCAGTTGATTTAGGTATTTTTTCGCTTCACTTAGCAGGAGTTTCTTCTATTTTAGGTGCTGTAAACTTCATAACTACAGTTATTAATATACGTTCATTTGGTATAATAATGGATCAAATACCTTTATTCGTGTGAGCTGTTTTTATTACCGCTATCCTATTGCTACTATCTCTACCAGTTTTAGCAGGTGCTATTACTATACTTCTTACTGATCGAAATTTGAATACTTCATTCTTTGACCCAGCTGGGGGAGGTGATCCTGTTTTATATCAACATCTATTT

2362  

-
-