• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for Urophycis chuss

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: FDA 021
Common Name: Red Hake
FDA Market Name: Hake
Voucher Location*: NMNH
Voucher Number: USNM-394058
Metadata: Authenicated: yes; vouchered: yes
Single Lab validation study
CO1 DNA Sequence (barcode, FASTA format)
FDA Seafood List: Search Urophycis chuss on the FDA Seafood List
Barcode: 5' barcode (~655 bp):
>FDA_021|Urophycis_chuss
CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGTACAGCCCTAAGCCTACTTATCCGAGCAGAATTAAGTCAACCAGGCACCCTCCTGGGCGACGATCAGATTTATAATGTTATCGTAACAGCACATGCCTTCGTAATAATCTTCTTTATGGTTATGCCCTTAATAATTGGAGGTTTCGGAAATTGGCTTGTCCCCCTAATAATTGGTGCCCCCGATATGGCTTTCCCCCGTATGAATAATATAAGTTTCTGACTCCTCCCCCCCTCCTTCTTGCTTCTGTTAGCATCTTCTGGGGTAGAAGCTGGTGCCGGAACAGGCTGAACAGTTTACCCCCCCCTGGCAAGTAATCTTGCCCACGCTGGTGCATCTGTCGATCTCACTATCTTCTCCCTTCACCTAGCAGGTATTTCATCAATTCTTGGAGCCATTAATTTTATCACTACCATTATTAACATGAAGCCTCCTACCACAACACTTTATCACATACCCCTATTTGTGTGAGCCGTTCTTATTACAGCCGTCCTCCTTCTTCTCTCTCTTCCTGTCTTAGCTGCCGGCATTACTATACTTCTCACAGACCGAAACCTCAACACTTCTTTCTTTGACCCTTCTGGAGGAGGAGACCCCATTCTTTACCAACACCTATTT

96  

-
-