• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for Acipenser transmontanus

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: FDA 286
Common Name: White Sturgeon
FDA Market Name: Sturgeon
Voucher Location*: NMNH
Voucher Number: 410953
Metadata: Authenticated: yes; vouchered: yes
Collected 2013, North American Seafood Expo, Boston, MA
Barcode: 5' barcode (~655 bp):
>FDA_286_Acipenser_transmontanus
CCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCTTGCTTGGCGATGACCAGATCTACAATGTTATCGTTACAGCCCACGCCTTTGTCATGATCTTCTTTATAGTAATACCCATCATAATTGGCGGATTCGGAAACTGACTGGTCCCCCTAATAATTGGAGCCCCAGACATGGCATTCCCTCGCATGAACAATATGAGCTTCTGGCTCCTACCCCCATCCTTCCTACTCCTTTTGGCCTCCTCTGGGGTAGAGGCCGGGGCCGGCACAGGGTGAACTGTTTACCCCCCACTGGCGGGAAACCTGGCCCATGCAGGAGCCTCTGTAGACCTAACCATTTTCTCCCTCCACCTGGCCGGGGTGTCGTCCATTTTAGGAGCTATTAATTTTATTACCACAATTATCAACATGAAACCCCCCGCAGTATCCCAGTATCAGACACCTCTATTTGTGTGATCTGTATTAATCACGGCCGTACTTCTCCTACTGTCACTGCCAGTGCTAGCTGCGGGAATCACAATACTCCTAACAGACCGGAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTCTACCAACACCTATTT
Small photo (500 x 375 px): Small photo
Photo display (500 x 375 px):
Photographer: J. Deeds

2362  

-
-