Reference Standard Sequence Library (RSSL) for Seafood Identification
-
Additional Information for Aplodinotus grunniens
This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.
| Sample ID: | FDA 297 |
|---|---|
| Search the Seafood List: | Search Aplodinotus grunniens on the FDA Seafood List |
| Common Name: | Freshwater Drum |
| FDA Market Name: | Drum, Freshwater |
| Voucher Location*: | NMNH |
| Voucher Number: | USNM-437316 |
| Metadata: |
Authenticated: yes; vouchered: yes Collected 2013, North American Seafood Expo, Boston, MA |
| Barcode 5' barcode 655bp: |
>FDA_297|Aplodinotus_grunniens
CCTCTACCTAGTTTTTGGTGCATGAGCCGGAATAGTAGGCACAGCTTTAAGCCTTCTTATCCGAGCAGAGCTAAGTCAACCTGGCTCACTCCTTGGAGATGACCAGATCTATAACGTAATTGTTACAGCACACGCCTTCGTTATAATTTTCTTTATAGTAATACCCGTTATGATCGGAGGCTTCGGAAACTGGCTCGTACCATTAATGATTGGAGCCCCTGATATGGCATTCCCTCGAATAAATAACATGAGCTTCTGACTTCTCCCCCCTTCCTTCCTCCTGCTCTTAACCTCCTCAGGGGTGGAAGCAGGGGCCGGGACAGGATGAACAGTCTACCCCCCACTTGCTGGAAATCTGGCACACGCAGGTGCTTCTGTTGACTTAGCTATCTTTTCCCTACATCTCGCAGGTGTCTCATCAATTCTAGGGGCTATCAACTTTATCACAACAATCATAAACATAAAACCGCCCGCTATTTCCCAATATCAAACACCCTTGTTCGTATGGGCCGTTTTAATTACAGCTGTTCTCCTACTACTTTCACTTCCCGTACTAGCTGCTGGCATTACAATACTTCTGACAGACCGCAATCTTAACACAACCTTCTTCGACCCAGCAGGAGGGGGCGATCCAATTCTTTACCAACACTTATTC |
| Photo display (500 x 375 px): |
|
| Flickr <exit disclaimer>: | View Aplodinotus grunniens, FDA 297 on Flickr |
| Photographer: | J. Deeds |
*Sources for vouchered specimens:
- NMNH: National Museum of Natural History, Smithsonian Inst. <exit disclaimer>
- CAS: California Academy of Sciences <exit disclaimer>
- ULLZ: University of Louisiana at Lafayette
- NMNST: National Museum of Nature and Science, Tokyo, Japan <exit disclaimer>
- ZCR: Zoological Records Collection (ZRC) at the Lee Kong Chian Natural History Museum in Singapore. <exit disclaimer>
Note: when you open the links followed by an <exit disclaimer>, you will be leaving the FDA site.
-
