• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for Gerres shima

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: LUZ 120
Search the Seafood List: Search Gerres shima on the FDA Seafood List
Common Name: Banded Silver-biddy
Voucher Location*: NMNH
Voucher Number: USNM-445337
Barcode 5' barcode 655bp:
>LUZ-120|Gerres_shima
CCTTTATCTTGTCTTCGGTGCTTGAGCTGGAATAGTAGGGACAGCCCTAAGCCTACTTATCCGAGCTGAATTAAGCCAACCCGGCTCTCTCCTTGGAGATGACCAAATCTACAACGTTATCGTCACTGCGCATGCGTTCGTAATAATTTTTTTCATGGTAATACCAATCATGATTGGAGGCTTCGGAAACTGACTGATCCCCCTAATGATCGGAGCCCCAGACATGGCGTTCCCCCGAATGAACAATATGAGCTTTTGACTTCTTCCTCCCTCATTCTTGCTTCTATTGGCCTCTTCAGGTGTAGAAGCCGGGGCCGGAACCGGATGAACAGTCTACCCTCCCCTGTCCGGAAACTTGGCCCACGCCGGAGCATCCGTCGACTTAACTATTTTCTCACTTCACCTAGCAGGTATTTCATCCATTCTTGGAGCCATCAACTTTATTACTACAATTATTAATATGAAACCACCAGCTATCTCGCAATACCAAACCCCTCTTTTCGTCTGAGCTGTATTAATTACCGCAGTTCTTCTTCTCCTGTCACTTCCCGTCCTAGCCGCAGGTATCACGATGCTTCTTACGGATCGAAACTTAAACACCACTTTCTTCGATCCTGCAGGGGGTGGTGATCCAATCCTCTACCAACATCTCTTC
-
-