Reference Standard Sequence Library (RSSL) for Seafood Identification
Additional Information for Ostorhinchus ishigakiensis
This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.
Sample ID: | PIL 525 |
---|---|
Search the Seafood List: | Search Ostorhinchus ishigakiensis on the FDA Seafood List |
Common Name: | Miyako-ishimochi |
Voucher Location*: | CAS |
Metadata: | California Academy of Sciences |
Barcode 5' barcode 655bp: |
>PIL-525|Ostorhinchus_ishigakiensis
CCTCTATTTAGTGTTTGGTGCTTGAGCCGGAATAGTCGGGACGGCCCTAAGTCTTCTCATCCGGGCTGAACTAAGTCAACCCGGGGCTCTTCTTGGGGACGACCAGATTTATAATGTAATCGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGAAACTGACTAATTCCACTCATAATCGGAGCCCCTGACATAGCATTCCCCCGTATGAACAACATAAGCTTCTGACTTCTTCCTCCATCCTTTCTTCTACTTCTTGCCTCCTCCGGTGTAGAAGCAGGGGCTGGTACGGGATGAACTGTTTATCCCCCTTTAGCAGGTAACCTAGCCCATGCGGGCGCCTCCGTAGACTTAACAATTTTTTCCCTTCACCTTGCAGGTGTTTCTTCCATTTTAGGGGCTATTAACTTTATCACCACAATTATTAACATGAAACCTCCAGCTACCACCCAATACCAAACCCCCCTATTTGTATGGGCAGTCCTAATTACTGCTGTCCTTCTCCTTCTTTCTCTTCCCGTCTTAGCTGCTGGAATTACAATACTTCTCACAGACCGAAATCTGAACACAACTTTCTTTGATCCTGCCGGAGGGGGTGACCCCATCCTTTATCAACACCTATTT |
*Sources for vouchered specimens:
- NMNH: National Museum of Natural History, Smithsonian Inst. <exit disclaimer>
- CAS: California Academy of Sciences <exit disclaimer>
- ULLZ: University of Louisiana at Lafayette
- NMNST: National Museum of Nature and Science, Tokyo, Japan <exit disclaimer>
- ZCR: Zoological Records Collection (ZRC) at the Lee Kong Chian Natural History Museum in Singapore. <exit disclaimer>
Note: when you open the links followed by an <exit disclaimer>, you will be leaving the FDA site.