Additional Information for Variola albimarginata

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

• Sample ID: VERDE 525
• Search the Seafood List: Search Variola albimarginata on the FDA Seafood List
• Common Name: White-edged Lyretail
• FDA Market Name: Lyretail
• Voucher Location*: CAS
• Voucher Number: USNM-436391
• Barcode 5' barcode 655bp: >VERDE-525|Variola_albimarginata; CTTATATCTAGTGTTCGGTGCCTGAGCTGGAATGGTAGGAACTGCCTTAAGCCTACTAATTCGTGCAGAACTAAGCCAGCCAGGGGCTCTCTTAGGCGATGACCAGATCTATAATGTAATCGTTACTGCCCACGCATTCGTGATGATCTTCTTTATAGTAATGCCAATCATGATTGGCGGGTTCGGAAACTGACTTATTCCTCTGATAATCGGCGCTCCTGATATAGCATTTCCTCGAATAAATAACATAAGCTTCTGACTTCTCCCTCCTTCTTTCTTACTACTCCTTGCCTCGTCTGGCGTAGAAGCGGGTGCTGGTACTGGATGAACAGTCTATCCACCCCTGGCAGGTAATCTAGCCCACGCAGGTGCTTCTGTTGACTTAACTATTTTCTCTCTTCACTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAATTTCATTACAACTATTATTAACATAAAACCCCCAGCTATTTCTCAATACCAAACACCCCTCTTTGTCTGAGCCGTACTTATCACTGCTGTATTGCTTCTTCTCTCCCTTCCAGTTCTCGCTGCCGGTATTACAATATTATTAACAGACCGTAACCTTAACACCACTTTCTTTGACCCAGCGGGAGGGGGAGACCCTATTCTTTACCAACACTTATTC

*Sources for vouchered specimens:

• NMNH: National Museum of Natural History, Smithsonian Inst. <exit disclaimer>
• CAS: California Academy of Sciences <exit disclaimer>
• ULLZ: University of Louisiana at Lafayette
• NMNST: National Museum of Nature and Science, Tokyo, Japan <exit disclaimer>
• ZCR: Zoological Records Collection (ZRC) at the Lee Kong Chian Natural History Museum in Singapore. <exit disclaimer>

Note: when you open the links followed by an <exit disclaimer>, you will be leaving the FDA site.