Additional Information for Hemigymnus melapterus

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

• Sample ID: VIS 336
• Search the Seafood List: Search Hemigymnus melapterus on the FDA Seafood List
• Common Name: Blackeyed Thicklip
• Voucher Location*: NMNH
• Voucher Number: USNM-435683
• Metadata: Authenticated: yes; vouchered: yes; National Musum of Natural History (NMNH)); CO1 DNA Sequence (barcode, FASTA format)
• Barcode 5' barcode 655bp: >VIS-336|Hemigymnus_melapterus; CCTCTACCTGGTATTCGGCGCTGAGCTGGGATAGTAGGCACAGCCCTGAGCCTACTAATTCGAGCTGAACTGAGCCAACCCGGCGCTCTCCTTGGAGACGATCAGATTTATAATGTAATTGTTACAGCCCACGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGATTAATCCCTTTAATGATTGGAGCCCCCGACATAGCTTTCCCTCGAATAAACAACATGAGCTTCTGACTTCTACCTCCCTCCTTCCTACTCCTTCTTGCATCCTCTGGCGTCGAAGCAGGCGCCGGGACTGGTTGAACAGTCTACCCGCCCCTAGCAGGAAACCTAGCCCATGCCGGCGCATCCGTTGATTTAACCATTTTCTCTCTGCACCTGGCTGGGATTTCGTCCATCCTCGGCGCTATCAACTTTATTACAACTATTATCAACATGAAGCCACCCGCTATCTCCCAATATCAAACGCCTCTGTTCGTCTGAGCTGTACTAATCACGGCGGTACTTCTTCTTCTTTCCCTACCCGTCCTTGCCGCTGGTATTACAATACTCCTGACGGACCGAAACCTGAATACCACTTTCTTTGACCCCGCTGGCGGGGGAGATCCAATCCTATATCAACACTTATTC

*Sources for vouchered specimens:

• NMNH: National Museum of Natural History, Smithsonian Inst. <exit disclaimer>
• CAS: California Academy of Sciences <exit disclaimer>
• ULLZ: University of Louisiana at Lafayette
• NMNST: National Museum of Nature and Science, Tokyo, Japan <exit disclaimer>
• ZCR: Zoological Records Collection (ZRC) at the Lee Kong Chian Natural History Museum in Singapore. <exit disclaimer>

Note: when you open the links followed by an <exit disclaimer>, you will be leaving the FDA site.